Question 2 MCQ · 1.0 marks
How many solutions are possible for a string reconstruction problem with 12 words?
A published solution is not available for this question yet.
Big Data and Biological Networks · Quiz 2 · Jan 2024
Big Data and Biological Networks · Quiz 2 · Jan 2024
← Course papers · Start practice / exam
Questions and published explanations below are available without starting a test. Some questions may not have a published solution yet.
0 / 21 published solutions
Question 3 MCQ · 1.0 marks
What is the number of 4-mers generated from the sequence :
“AGATATATTATTGTCTTTTTTGTCA”?
20
22
15
21
A published solution is not available for this question yet.
Question 4 MCQ · 2.0 marks
What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed
from “ATGATACT”?
4.1
2.4
3.4
2
A published solution is not available for this question yet.
Question 5 MCQ · 2.0 marks
What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained
from “ATGATCTAAATATCAAG”?
15
14
16
17
A published solution is not available for this question yet.
Question 6 MCQ · 2.0 marks
In a directed protein-protein interaction network, the researchers want to identify protein clusters
that interact densely with each other but have sparse connections to other proteins in the
network. Which method would be the most effective in discovering these hubs?
Using betweenness centrality.
Using the degree distribution.
Using Girvan-Newman algorithm.
Finding nodes with high in-degree but low out-degree.
A published solution is not available for this question yet.
Question 7 MCQ · 2.0 marks
Which of the following statements is true regarding motif identification in networks?
Motifs are patterns found in random networks
Motifs are exclusively found in biological networks and are absent in other
types of networks.
Motif identification involves detecting recurring and significant subgraph
patterns in a network.
Motifs are only relevant in small networks and have no significance in larger-
scale networks.
A published solution is not available for this question yet.
Question 8 MCQ · 2.0 marks
Consider the gene interaction networks given below for 4 different conditions (2 normal and 2
diseased).
Which of the following can be observed from the networks shown?
A-E is a housekeeping interaction
E-B is a housekeeping interaction
A-D is a differential interaction between normal and disease networks
E-D is a differential interaction between normal and disease networks
A published solution is not available for this question yet.
Question 9 MCQ · 2.0 marks
Investigator X is tasked with identifying the spread of a virus in a city. The team has narrowed
down the origin of the spread to 4 locations and obtained the contact tracing information for 4
suspected individuals. The social contact network is represented as a bipartite graph. Answer the
following questions based on the provided network.
Find the projection of the location contact network at 11:00. Note: No transition time is considered
for traveling between locations.
A published solution is not available for this question yet.
Question 10 MCQ · 2.0 marks
(i)-A, (ii) - B, (iii) -C
(i)-B, (ii) - A, (iii) -C
(i)-C, (ii) - A, (iii) -B
(i)-C, (ii) - B, (iii) -A
A published solution is not available for this question yet.
Question 11 MCQ · 3.0 marks
What is the total number of nodes of the De-Bruijn Graph generated from the 2-mers obtained
from “TACTCTAAG”?
3
5
6
4
A published solution is not available for this question yet.
Question 12 MCQ · 3.0 marks
Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “+2”,
mismatches: “-3” and gap: “-1”, find the final score for the best global alignment between the two
sequences.
10
11
2
8
A published solution is not available for this question yet.
Question 13 MCQ · 3.0 marks
Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’,
’ATGCC’, reconstruct the sequence from which the k-mers were generated.
CTATACCGTAGGCG
CTATGCCGTAGGCG
ATCGGTACAACGG
TATGCCGTAGGCGC
A published solution is not available for this question yet.
Question 14 MSQ · 2.0 marks
We have a graph that was constructed by comparing n DNA sequences. If the two sequences can
be aligned with a score greater than a threshold value, we assign an edge between the two in the
graph. Given this, which of the following is true:
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete
graph
There will be two connected components in the resultant graph
A published solution is not available for this question yet.
Question 15 MSQ · 2.0 marks
Which of the following makes an appropriate pair?
Node classification – Predicting drug-drug interaction
Graph classification – Predicting toxicity of a chemical compound
Link Prediction – Predicting function of novel proteins
Graph regression – Predicting free energy of hydration
A published solution is not available for this question yet.
Question 16 MSQ · 3.0 marks
Which of these are challenges one might encounter in the process of genome assembly?
Erroneous reads
Large volumes of data
Duplicate sequences
Incomplete graph
A published solution is not available for this question yet.
Question 17 MSQ · 3.0 marks
Consider the following two statements:
Statement 1: Reads from the genome sequencing are prone to error.
Statement 2: Sequence alignment can be used to overcome this problem.
Based on your observations, which of the following statements is not true?
Both statements are true and statement 2 is a potential solution for statement
1
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
A published solution is not available for this question yet.
Question 18 MSQ · 3.0 marks
A published solution is not available for this question yet.
Question 19 MSQ · 3.0 marks
A published solution is not available for this question yet.
Question 20 MCQ · 3.0 marks
Use the following metabolic network to answer the given questions.
What is the dimension of the stoichiometric matrix of the provided network?
4×4
5×5
4×5
5×4
A published solution is not available for this question yet.
Question 21 MCQ · 3.0 marks
Use the following metabolic network to answer the given questions.
R1 - R2
b1 + b2 - R2
b1 + b2 - b3
R2 - R1
A published solution is not available for this question yet.
Question 22 MCQ · 3.0 marks
Use the following metabolic network to answer the given questions.
What is the stoichiometric matrix of the provided network? Note: The order of reactions is (R1, R2,
b1, b2, b3)
**SW Engg**
**Section Id :** 64065353055
**Section Number :** 2
**Section type :** Online
**Mandatory or Optional :** Mandatory
**Number of Questions :** 22
A published solution is not available for this question yet.